ID: 1032565851_1032565855

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1032565851 1032565855
Species Human (GRCh38) Human (GRCh38)
Location 7:132942100-132942122 7:132942122-132942144
Sequence CCTATACAATTCTAGGCCTATAT TTCATTGGCTGGAAACATTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!