ID: 1032578565_1032578577

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1032578565 1032578577
Species Human (GRCh38) Human (GRCh38)
Location 7:133081856-133081878 7:133081905-133081927
Sequence CCCGGATGCCCTTCACCACGGTG GGTGACCCGGCGGGTGCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 118} {0: 2, 1: 0, 2: 2, 3: 25, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!