ID: 1032621887_1032621899 |
View in Genome Browser |
Spacer: 21 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1032621887 | 1032621899 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 7:133542582-133542604 | 7:133542626-133542648 |
| Sequence | CCAGCCTTGGGCAAGAGGGATTC | GGGGAGAATAGGACTGAGGAGGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 28, 2: 83, 3: 161, 4: 356} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||