ID: 1032635922_1032635923

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1032635922 1032635923
Species Human (GRCh38) Human (GRCh38)
Location 7:133708677-133708699 7:133708707-133708729
Sequence CCAAACTGAGTCTCAGTAAGTTG TTACACAGCTTGTAAGTAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 145} {0: 1, 1: 0, 2: 9, 3: 54, 4: 336}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!