|
Left Crispr |
Right Crispr |
| Crispr ID |
1032660771 |
1032660775 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:133981562-133981584
|
7:133981607-133981629
|
| Sequence |
CCAGTCAGAATAGCTATTATTAA |
CTGGTAAGGTTGTGGAAAAAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 125, 1: 1531, 2: 4204, 3: 5551, 4: 20581} |
{0: 1, 1: 35, 2: 483, 3: 1985, 4: 4314} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|