ID: 1032680983_1032680986

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1032680983 1032680986
Species Human (GRCh38) Human (GRCh38)
Location 7:134183041-134183063 7:134183079-134183101
Sequence CCATCGCGCCCGGCTGCGGGAGA CATTCTTTAGTCCAGTCTTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!