ID: 1032687735_1032687739

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1032687735 1032687739
Species Human (GRCh38) Human (GRCh38)
Location 7:134252659-134252681 7:134252675-134252697
Sequence CCTATGCCCAGCAGCACATGGGC CATGGGCTTTCCAGGAGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 29, 4: 216} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!