ID: 1032761062_1032761069

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1032761062 1032761069
Species Human (GRCh38) Human (GRCh38)
Location 7:134942282-134942304 7:134942329-134942351
Sequence CCAAAGCCTTTGTAATATTCAAA ATATTTCAGTCTCATCCAAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 13, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!