ID: 1032784536_1032784541

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1032784536 1032784541
Species Human (GRCh38) Human (GRCh38)
Location 7:135190109-135190131 7:135190159-135190181
Sequence CCAAAGCCGGCTTTCACTATGGG TTCCCATTCTGCTACCCATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 59} {0: 1, 1: 0, 2: 0, 3: 18, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!