ID: 1032790438_1032790447

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1032790438 1032790447
Species Human (GRCh38) Human (GRCh38)
Location 7:135238498-135238520 7:135238540-135238562
Sequence CCAGATTCCCTACAAGCCCAGAG TGAGACTGTTAGAGAACTTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!