ID: 1032800871_1032800877

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1032800871 1032800877
Species Human (GRCh38) Human (GRCh38)
Location 7:135316452-135316474 7:135316482-135316504
Sequence CCCAGTTCCAGCAGAGCAACGTG AAACCAGCAGCATCTCAGAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 54, 4: 393}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!