ID: 1032826240_1032826245

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1032826240 1032826245
Species Human (GRCh38) Human (GRCh38)
Location 7:135571385-135571407 7:135571411-135571433
Sequence CCTGATGACATGTACCCCTAAAC TAAAAAAAAAAAAAAAGACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 78} {0: 12, 1: 552, 2: 5556, 3: 53306, 4: 80328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!