ID: 1032841179_1032841188

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1032841179 1032841188
Species Human (GRCh38) Human (GRCh38)
Location 7:135714617-135714639 7:135714645-135714667
Sequence CCCGCATGCAGAGGACCGGTCAG ATGGCGAGGAGAGATGGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 84} {0: 1, 1: 0, 2: 6, 3: 74, 4: 541}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!