ID: 1032845086_1032845093

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1032845086 1032845093
Species Human (GRCh38) Human (GRCh38)
Location 7:135745417-135745439 7:135745434-135745456
Sequence CCCTTCCAGTGGTGCCCTGGCAG TGGCAGGACCTGGTATGTGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 13, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!