ID: 1032845087_1032845094

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1032845087 1032845094
Species Human (GRCh38) Human (GRCh38)
Location 7:135745418-135745440 7:135745435-135745457
Sequence CCTTCCAGTGGTGCCCTGGCAGG GGCAGGACCTGGTATGTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 226} {0: 1, 1: 0, 2: 2, 3: 30, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!