ID: 1032847990_1032847995

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1032847990 1032847995
Species Human (GRCh38) Human (GRCh38)
Location 7:135768272-135768294 7:135768294-135768316
Sequence CCTGCAATCCTTAGGGTGGGGAC CATGGAAGGCAGAGCTTAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 91} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!