ID: 1032850245_1032850249

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1032850245 1032850249
Species Human (GRCh38) Human (GRCh38)
Location 7:135788854-135788876 7:135788871-135788893
Sequence CCAGGGTTTAGAGAGGGCCACGG CCACGGTGTTTGGCTGATTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 141} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!