ID: 1032866390_1032866393

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1032866390 1032866393
Species Human (GRCh38) Human (GRCh38)
Location 7:135929546-135929568 7:135929587-135929609
Sequence CCAAATATGTAGAGTTGGCCTTT CACAATCTAATAAATTAGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 136} {0: 1, 1: 0, 2: 4, 3: 112, 4: 3163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!