ID: 1032962032_1032962040

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1032962032 1032962040
Species Human (GRCh38) Human (GRCh38)
Location 7:137046832-137046854 7:137046859-137046881
Sequence CCTACATAAGAATGACCTCATTA CAGAAGAAGGAGGAGGGGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 6, 2: 91, 3: 645, 4: 3874}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!