ID: 1033017823_1033017825

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1033017823 1033017825
Species Human (GRCh38) Human (GRCh38)
Location 7:137690043-137690065 7:137690062-137690084
Sequence CCAACATCAGAATCTCATACAGA CAGAGCTCAAAATTTCCCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 322} {0: 1, 1: 0, 2: 3, 3: 18, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!