ID: 1033042816_1033042823

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1033042816 1033042823
Species Human (GRCh38) Human (GRCh38)
Location 7:137933762-137933784 7:137933796-137933818
Sequence CCAGATGCTATGACTCAGCCCAG CAGCTGGGTGTCCTTGGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 178} {0: 1, 1: 0, 2: 6, 3: 25, 4: 331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!