ID: 1033045872_1033045884

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1033045872 1033045884
Species Human (GRCh38) Human (GRCh38)
Location 7:137961827-137961849 7:137961877-137961899
Sequence CCTACCCCAGGCCTTTCCTCCAT CCCAATGCTCAGTCTCTCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 521} {0: 1, 1: 0, 2: 2, 3: 10, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!