ID: 1033056571_1033056580

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1033056571 1033056580
Species Human (GRCh38) Human (GRCh38)
Location 7:138060232-138060254 7:138060266-138060288
Sequence CCCTGAGGGTGGTGTGACCCCCA CTTTAGGGATGGTTTAGAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 203} {0: 2, 1: 3, 2: 9, 3: 38, 4: 422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!