ID: 1033068526_1033068530

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1033068526 1033068530
Species Human (GRCh38) Human (GRCh38)
Location 7:138179994-138180016 7:138180016-138180038
Sequence CCAGCCTCCTTCTCCTACTTGTC CTTTCAGAATAATAGTAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 67, 4: 842} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!