ID: 1033072367_1033072369

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1033072367 1033072369
Species Human (GRCh38) Human (GRCh38)
Location 7:138215840-138215862 7:138215865-138215887
Sequence CCATGGAAAAAGGACCTAACAAA ATGCCCTTCTAGAAGAGTGAAGG
Strand - +
Off-target summary {0: 39, 1: 40, 2: 27, 3: 29, 4: 254} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!