ID: 1033099767_1033099774

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1033099767 1033099774
Species Human (GRCh38) Human (GRCh38)
Location 7:138460350-138460372 7:138460371-138460393
Sequence CCGGCCGCGCCACTCGGGAGGCG CGGATCCCGTGGGCCTGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 500} {0: 1, 1: 0, 2: 0, 3: 13, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!