ID: 1033109924_1033109929

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1033109924 1033109929
Species Human (GRCh38) Human (GRCh38)
Location 7:138564682-138564704 7:138564706-138564728
Sequence CCCAATCACCACCTTAAATACAT GCCAATTGTTTCCCTATCTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 11, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!