ID: 1033110753_1033110755

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1033110753 1033110755
Species Human (GRCh38) Human (GRCh38)
Location 7:138572920-138572942 7:138572937-138572959
Sequence CCTTTTCTCCTACAAAACAACAG CAACAGTAATGTATTCAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 511} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!