ID: 1033129700_1033129710

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1033129700 1033129710
Species Human (GRCh38) Human (GRCh38)
Location 7:138735293-138735315 7:138735326-138735348
Sequence CCCTGTCCCCACCTGTACTTGAG AATTGTTTTCAGGTTTGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 198} {0: 1, 1: 0, 2: 1, 3: 22, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!