ID: 1033138137_1033138143

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1033138137 1033138143
Species Human (GRCh38) Human (GRCh38)
Location 7:138801635-138801657 7:138801667-138801689
Sequence CCCAGGTCAGCAGCTAACAATGC AAATGCTTGAAGAAGTTTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 116} {0: 1, 1: 0, 2: 0, 3: 27, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!