ID: 1033139025_1033139029

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1033139025 1033139029
Species Human (GRCh38) Human (GRCh38)
Location 7:138808719-138808741 7:138808734-138808756
Sequence CCCTTAATTGTCTACATTTAAGG ATTTAAGGCCCCATAAACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 218} {0: 1, 1: 0, 2: 2, 3: 11, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!