ID: 1033146132_1033146134

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1033146132 1033146134
Species Human (GRCh38) Human (GRCh38)
Location 7:138871300-138871322 7:138871329-138871351
Sequence CCACGTGCTCGAAGATGGAGGCT TGCTGCTCATTTCCCGAACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 73} {0: 1, 1: 0, 2: 0, 3: 7, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!