|
Left Crispr |
Right Crispr |
| Crispr ID |
1033148973 |
1033148981 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:138896745-138896767
|
7:138896790-138896812
|
| Sequence |
CCCACCATGCCCAGCTAGCTTAT |
GGGGTCTTGCTATGTTTCCCAGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 120, 1: 2679, 2: 11549, 3: 46698, 4: 133589} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|