ID: 1033172214_1033172225

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1033172214 1033172225
Species Human (GRCh38) Human (GRCh38)
Location 7:139094171-139094193 7:139094205-139094227
Sequence CCATTAGATTCCTGGGCCCCCAC TGAATCAGTAAATCTAGGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 133} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!