ID: 1033185542_1033185548

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1033185542 1033185548
Species Human (GRCh38) Human (GRCh38)
Location 7:139224890-139224912 7:139224940-139224962
Sequence CCTTCTTCGGTCTCCCTCTGTTG CGCTGCAACCTCCCTGCCTCGGG
Strand - +
Off-target summary No data {0: 39, 1: 30, 2: 34, 3: 115, 4: 1446}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!