ID: 1033186059_1033186063

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1033186059 1033186063
Species Human (GRCh38) Human (GRCh38)
Location 7:139227676-139227698 7:139227716-139227738
Sequence CCACAGCTCGTCTCTTCATCTTG AGCAAATGTACTTGGCGTACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 2, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!