ID: 1033213989_1033213996

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1033213989 1033213996
Species Human (GRCh38) Human (GRCh38)
Location 7:139481032-139481054 7:139481057-139481079
Sequence CCGTGCCCAGCTTCAGGAGCCTT ATGTGGAAGAGGAAGACAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 11, 3: 92, 4: 799}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!