ID: 1033221899_1033221904

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1033221899 1033221904
Species Human (GRCh38) Human (GRCh38)
Location 7:139532464-139532486 7:139532507-139532529
Sequence CCCTGGATGGCAGCTGGGCTTAG AGCAGGTCAGAAAGTTCCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 209} {0: 1, 1: 0, 2: 1, 3: 25, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!