ID: 1033249654_1033249664

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1033249654 1033249664
Species Human (GRCh38) Human (GRCh38)
Location 7:139747708-139747730 7:139747740-139747762
Sequence CCAGCCCTCCTGTGGCCTCCACT GGCACCCCCGGTTTTTCCCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!