ID: 1033256944_1033256952

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1033256944 1033256952
Species Human (GRCh38) Human (GRCh38)
Location 7:139809722-139809744 7:139809768-139809790
Sequence CCAGCTCCGAGAGTGAGTGTGGA CAGGTCCAAAGCTGAATGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 118} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!