ID: 1033256946_1033256955

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1033256946 1033256955
Species Human (GRCh38) Human (GRCh38)
Location 7:139809749-139809771 7:139809787-139809809
Sequence CCTGCCTTTTTGTTCTATCCAGG GTGGTGCCCGTCCATGTTGAGGG
Strand - +
Off-target summary {0: 3, 1: 17, 2: 30, 3: 69, 4: 235} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!