ID: 1033262853_1033262863

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1033262853 1033262863
Species Human (GRCh38) Human (GRCh38)
Location 7:139858603-139858625 7:139858646-139858668
Sequence CCTGCAGCATCCTGGTACCCGGA CATGCTTGGTATCTGCTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 219} {0: 1, 1: 0, 2: 0, 3: 21, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!