ID: 1033271966_1033271971

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1033271966 1033271971
Species Human (GRCh38) Human (GRCh38)
Location 7:139940138-139940160 7:139940153-139940175
Sequence CCAAAAGCAGCTCCCCTTTGCAT CTTTGCATATGAAGAGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 183} {0: 1, 1: 0, 2: 1, 3: 28, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!