ID: 1033285407_1033285413

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1033285407 1033285413
Species Human (GRCh38) Human (GRCh38)
Location 7:140037011-140037033 7:140037033-140037055
Sequence CCAAAGTCGCCTACAGAAAAGAT TGGCAGCAGGCCAGGCGCGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 79, 3: 682, 4: 3701}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!