ID: 1033288605_1033288612

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1033288605 1033288612
Species Human (GRCh38) Human (GRCh38)
Location 7:140062725-140062747 7:140062756-140062778
Sequence CCGCTCCAGCGCGTCGGCGCTCA CGCAAGCGGCGCCGCAGCTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 43} {0: 1, 1: 0, 2: 0, 3: 7, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!