ID: 1033300011_1033300018

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1033300011 1033300018
Species Human (GRCh38) Human (GRCh38)
Location 7:140177016-140177038 7:140177054-140177076
Sequence CCTGCAGCAGCCGCGGCGGCGGC GCGCGCGAGGCCGCGGCGGCTGG
Strand - +
Off-target summary {0: 1, 1: 11, 2: 63, 3: 254, 4: 1079} {0: 1, 1: 0, 2: 6, 3: 81, 4: 486}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!