ID: 1033351888_1033351894

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1033351888 1033351894
Species Human (GRCh38) Human (GRCh38)
Location 7:140568643-140568665 7:140568673-140568695
Sequence CCACGCCTTGCCAAGCAAGCTCC CGCTTCTGTCCCTCATACTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 221} {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!