ID: 1033366813_1033366822

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1033366813 1033366822
Species Human (GRCh38) Human (GRCh38)
Location 7:140678340-140678362 7:140678385-140678407
Sequence CCCACCGGGCCACATCCAGGTGT ACTGGCATTGAGGTCTGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 81} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!