ID: 1033380732_1033380735

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1033380732 1033380735
Species Human (GRCh38) Human (GRCh38)
Location 7:140815476-140815498 7:140815507-140815529
Sequence CCCAGGCTTGTGCAATGGTGCGA CACTGCAAACTCCACTTCACAGG
Strand - +
Off-target summary No data {0: 1, 1: 71, 2: 4112, 3: 56319, 4: 149399}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!