ID: 1033387839_1033387846

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1033387839 1033387846
Species Human (GRCh38) Human (GRCh38)
Location 7:140896200-140896222 7:140896250-140896272
Sequence CCTTGTAGTTTTGGGTCTTACAG TTTTTGTATAGGGTGAGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 253} {0: 9, 1: 47, 2: 201, 3: 447, 4: 858}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!